Glyma02g17181 - SoyBase

SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g17181

Feature Type:	gene_model
Chromosome:	Gm02
Start:	15498103
stop:	15501854
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma02g17181

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G47890	AT	Annotation by Michelle Graham. TAIR10: B-box type zinc finger protein with CCT domain \| chr2:19608245-19609476 FORWARD LENGTH=332	SoyBase	E_val: 6.00E-68	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0009611	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to wounding	SoyBase	N/A	ISS
GO:0009805	GO-bp	Annotation by Michelle Graham. GO Biological Process: coumarin biosynthetic process	SoyBase	N/A	ISS
GO:0009963	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of flavonoid biosynthetic process	SoyBase	N/A	ISS
GO:0005622	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: intracellular	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0008270	GO-mf	Annotation by Michelle Graham. GO Molecular Function: zinc ion binding	SoyBase	N/A	ISS
PF06203	PFAM	CCT motif	JGI		ISS
UniRef100_D0EP04	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: CONSTANS-like zinc finger protein n=1 Tax=Glycine max RepID=D0EP04_SOYBN	SoyBase	E_val: 3.00E-118	ISS
UniRef100_UPI0002336E68	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI0002336E68 related cluster n=1 Tax=unknown RepID=UPI0002336E68	SoyBase	E_val: 0	ISS

Proteins Associated with Glyma02g17181

Locus	Gene Symbol	Protein Name
	COL13	Constans-like 13

Expression Patterns of Glyma02g17181

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma02g17181

Paralog	Evidence	Comments
Glyma10g02621	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma02g17181 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.02g152900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma02g17181

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma02g17181

Limit To All Plant Sequences

>Glyma02g17181.1   sequence type=CDS   gene model=Glyma02g17181   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATGAATGGTTCTCCAAATTCAAAACAGAGAACATGTGACTATTGCGGGAGCTTCACGGCTCTTCTGTACTGCAGAGCCGATTCTGCGAAGCTTTGTTTCTTCTGTGACCGTAAAGTTCACTTCCCAAACCAGCTTTTCTCGAAGCACAAGCGCGCGCAGCTCTGTGATGCGTGTGGAGATTCCCCTGCCTCGGTGCTCTGTTCTGCAGAAAACTCTGTTCTGTGCCAAAACTGTGATTGCGGAAAGCAAAAACATTTGGTGTCTGAGGCGCACCAACGGAGGCCACTCGAGGGGTTCTCGGGGTGCCCTTCTGTGACTGAGTTGTTAACAATTCTGGGTCTCAGTGAAAAATCTCTGCTTTCAAATGAGGGAACTTCCCAGATTGATGATGACCTTTCGGATTTGCACGTGTGGAGTGCTCCTTCTATTAATGGTCTTGAAGATTTGATCACTACCACAGCTTCTTCTCAAAAGAAACGTAAGGGTGCGTGCGGGAGACACAAAGAAGAGATTCTTAGTCAACTCCGTGAGCTAATAAAGTTGGAGCCCGACTTGATTCATGCTGAACGACAAGGGCAATTTGGAAATTTGCCTACTGATTTTGAACGAGACGTGGAGGCTAATATATTTCCTTCATATGAGGTAGGTGTGTTTTGTTGGCATGGAGAAAGCAGTGATCCTAGAAATCAAATTGTTCCTTCCGATACGTCACCATTGAGAGATTATGGCGATATAGTTTCAGCTGAAGATGGAAGTTTTACGATCACTGTGACTCACGCCAATTTTAACAACCAAGGGAAACCATCAAATTCTTTTAACGCTGAAAACTTATCTCCTACTCCTAAAGCTACTCCATACGAGTTGACAAGTCATGAAAGAGATTCAGCATTATTGCGATACAGAGAGAAGAAAAAATCCAGAAGATATGACAAGCACATCAGATATGAATCACGAAAAGTTCGGGCAGAAAGCAGGATGAGAATTAAGGGTAGGTTTGTCAGAGATGAAACACAAAAATAA

Predicted protein sequences of Glyma02g17181

Limit To All Plant Sequences

>Glyma02g17181.1   sequence type=predicted peptide   gene model=Glyma02g17181   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MMNGSPNSKQRTCDYCGSFTALLYCRADSAKLCFFCDRKVHFPNQLFSKHKRAQLCDACGDSPASVLCSAENSVLCQNCDCGKQKHLVSEAHQRRPLEGFSGCPSVTELLTILGLSEKSLLSNEGTSQIDDDLSDLHVWSAPSINGLEDLITTTASSQKKRKGACGRHKEEILSQLRELIKLEPDLIHAERQGQFGNLPTDFERDVEANIFPSYEVGVFCWHGESSDPRNQIVPSDTSPLRDYGDIVSAEDGSFTITVTHANFNNQGKPSNSFNAENLSPTPKATPYELTSHERDSALLRYREKKKSRRYDKHIRYESRKVRAESRMRIKGRFVRDETQK*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain